Skip to main content

pRRL-SV40-Puro-CMV-mCherry-EGFP-LC3B
(Plasmid #223712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti pRRL-SV40-Puro-CMV-MCS
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    LC3B
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1893
  • Entrez Gene
    MAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry::EGFP::LC3B (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer ccatagaagacaccgactctagaCCGCTAGCGCTACCGGTcgcc
  • 3′ sequencing primer acgaattctggtgctcgagttacactgacaatttcatcccgaacgtct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.12.12.571324 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL-SV40-Puro-CMV-mCherry-EGFP-LC3B was a gift from Benjamin Wolozin (Addgene plasmid # 223712 ; http://n2t.net/addgene:223712 ; RRID:Addgene_223712)
  • For your References section:

    Proximity labeling reveals dynamic changes in the SQSTM1 protein network. Ortiz ANR, Zhang L, Ash PEA, Basu A, Puri S, van der Spek SJF, Wang Z, Dorrian L, Emili A, Wolozin B. bioRxiv [Preprint]. 2024 Jun 27:2023.12.12.571324. doi: 10.1101/2023.12.12.571324. 10.1101/2023.12.12.571324 PubMed 38168279