Skip to main content

pHR-SFFV-FLAG-TurboID-SQSTM1
(Plasmid #223714)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 223714 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pHR-SFFV
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SQSTM1
  • Species
    H. sapiens (human)
  • Entrez Gene
    SQSTM1 (a.k.a. A170, DMRV, EBIAP, FTDALS3, NADGP, OSIL, PDB3, ZIP3, p60, p62, p62B)
  • Promoter SFFV
  • Tag / Fusion Protein
    • TurboID (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer agctctcgagaattctcacgc
  • 3′ sequencing primer gttatctagatccggtggatccttacaacggcgggggatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.12.12.571324 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SFFV-FLAG-TurboID-SQSTM1 was a gift from Benjamin Wolozin (Addgene plasmid # 223714 ; http://n2t.net/addgene:223714 ; RRID:Addgene_223714)
  • For your References section:

    Proximity labeling reveals dynamic changes in the SQSTM1 protein network. Ortiz ANR, Zhang L, Ash PEA, Basu A, Puri S, van der Spek SJF, Wang Z, Dorrian L, Emili A, Wolozin B. bioRxiv [Preprint]. 2024 Jun 27:2023.12.12.571324. doi: 10.1101/2023.12.12.571324. 10.1101/2023.12.12.571324 PubMed 38168279