pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD
(Plasmid
#223721)
-
PurposeExpress human diacylglycerol kinase delta 2- SAM domain deletion mutant (N-terminal TEV protease cleavable Twin-Strep-fusion protein) in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS-C-TEV-Twin-Strep
-
Backbone manufacturerChiaki Murakami
- Backbone size w/o insert (bp) 4860
- Total vector size (bp) 8322
-
Modifications to backboneTEV, Twin-Strep-tag, and stop codon (TGA) were subcloned into the XhoI/BglII site of pCAGGS.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDGKD
-
Alt nameDiacylglycerol kinase delta 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3432
-
Mutationdeleted sterile alpha motif domain (deleted amino acids 1144–1214)
-
GenBank IDNM_152879.3
-
Entrez GeneDGKD (a.k.a. DGK-delta, DGKdelta, dgkd-2)
- Promoter chicken β-actin promoter
-
Tags
/ Fusion Proteins
- Twin-Strep-tag (N terminal on backbone)
- TEV cleavable site (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert can be removed using the restriction enzyme, BglII.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD was a gift from Chiaki Murakami (Addgene plasmid # 223721 ; http://n2t.net/addgene:223721 ; RRID:Addgene_223721)