Skip to main content

pGECPL.BC10.MG
(Plasmid #223822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223822 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pECPV (EF1a-Cas9-P2A-Venus)
  • Backbone size w/o insert (bp) 14999
  • Total vector size (bp) 11325
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ef1a-Driven Cre-P2A-FLuc
  • gRNA/shRNA sequence
    TCTACACGCGCGTTCAACCG
  • Promoter Ef1a
  • Tag / Fusion Protein
    • P2A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCGAGGGTGGGGGAGAAC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGECPL.BC10.MG was a gift from Dawid Nowak (Addgene plasmid # 223822 ; http://n2t.net/addgene:223822 ; RRID:Addgene_223822)
  • For your References section:

    Clonal Lineage Tracing with Somatic Delivery of Recordable Barcodes Reveals Migration Histories of Metastatic Prostate Cancer. Serio RN, Scheben A, Lu B, Gargiulo DV, Patruno L, Buckholtz CL, Chaffee RJ, Jibilian MC, Persaud SG, Staklinski SJ, Hassett R, Brault LM, Ramazzotti D, Barbieri CE, Siepel AC, Nowak DG. Cancer Discov. 2024 Jul 5. doi: 10.1158/2159-8290.CD-23-1332. 10.1158/2159-8290.CD-23-1332 PubMed 38969342