pGECPL.BC10.MG
(Plasmid
#223822)
-
PurposeContains Cas9-editable barcode, marking guide (MG) for lineage tracing, Cre for Cas9 activation and loxP-mediated gene deletion, and Firefly Luciferase (FLuc) for live luminescence-based monitoring.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepECPV (EF1a-Cas9-P2A-Venus)
- Backbone size w/o insert (bp) 14999
- Total vector size (bp) 11325
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEf1a-Driven Cre-P2A-FLuc
-
gRNA/shRNA sequenceTCTACACGCGCGTTCAACCG
- Promoter Ef1a
-
Tag
/ Fusion Protein
- P2A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCGAGGGTGGGGGAGAAC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGECPL.BC10.MG was a gift from Dawid Nowak (Addgene plasmid # 223822 ; http://n2t.net/addgene:223822 ; RRID:Addgene_223822) -
For your References section:
Clonal Lineage Tracing with Somatic Delivery of Recordable Barcodes Reveals Migration Histories of Metastatic Prostate Cancer. Serio RN, Scheben A, Lu B, Gargiulo DV, Patruno L, Buckholtz CL, Chaffee RJ, Jibilian MC, Persaud SG, Staklinski SJ, Hassett R, Brault LM, Ramazzotti D, Barbieri CE, Siepel AC, Nowak DG. Cancer Discov. 2024 Jul 5. doi: 10.1158/2159-8290.CD-23-1332. 10.1158/2159-8290.CD-23-1332 PubMed 38969342