HCT3_rAAV-eHGT_1139m-minBglobin-SYFP2-WPRE3-BGHpA
(Plasmid
#223902)
-
PurposeDirect-expressing SYFP2 AAV virus
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonerAAV-minBglobin-SYFP2-WPRE3-BGHpA
-
Backbone manufacturerAllen Institute for Brain Science
- Backbone size w/o insert (bp) 4243
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSYFP2
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationN/A
- Promoter minBglobin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer CTAGAGATTGAACATGATACCCCAC
- 3′ sequencing primer CTTCACAGCAACATAACACTGATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HCT3_rAAV-eHGT_1139m-minBglobin-SYFP2-WPRE3-BGHpA was a gift from Tanya Daigle & Allen Institute for Brain Science (Addgene plasmid # 223902 ; http://n2t.net/addgene:223902 ; RRID:Addgene_223902) -
For your References section:
Enhancer AAVs for targeting spinal motor neurons and descending motor pathways in rodents and macaque. Kussick E, Johansen N, Taskin N, Chowdhury A, Quinlan MA, Fraser A, Clark AG, Wynalda B, Martinez R, Groce EL, Reding M, Liang E, Shulga L, Huang C, Casper T, Clark M, Ho W, Gao Y, van Velthoven CTJ, Sobieski C, Ferrer R, Berg MR, Curtis BC, English C, Day JC, Fortuna MG, Donadio N, Newman D, Yao S, Chakka AB, Goldy J, Torkelson A, Guzman JB, Chakrabarty R, Nguy B, Guilford N, Pham TH, Wright V, Ronellenfitch K, Naidoo R, Kenney J, Williford A, Ramakrishnan C, Drinnenberg A, Gudsnuk K, Thyagarajan B, Smith KA, Dee N, Deisseroth K, Zeng H, Yao Z, Tasic B, Levi BP, Hodge R, Bakken TE, Lein ES, Ting JT, Daigle TL. Cell Rep. 2025 Jun 24;44(6):115730. doi: 10.1016/j.celrep.2025.115730. Epub 2025 May 21. 10.1016/j.celrep.2025.115730 PubMed 40403722