Skip to main content

HCT40_rAAV-eHGT_1182m-minBglobin-SYFP2-WPRE3-BGHpA
(Plasmid #223917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223917 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    rAAV-minBglobin-SYFP2-WPRE3-BGHpA
  • Backbone manufacturer
    Allen Institute for Brain Science
  • Backbone size w/o insert (bp) 4242
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SYFP2
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Mutation
    N/A
  • Promoter minBglobin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer CTCTGTCACAAGGATGCTGG
  • 3′ sequencing primer CTAGATTAGCAGAAGTAGGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HCT40_rAAV-eHGT_1182m-minBglobin-SYFP2-WPRE3-BGHpA was a gift from Tanya Daigle & Allen Institute for Brain Science (Addgene plasmid # 223917 ; http://n2t.net/addgene:223917 ; RRID:Addgene_223917)
  • For your References section:

    Enhancer AAVs for targeting spinal motor neurons and descending motor pathways in rodents and macaque. Kussick E, Johansen N, Taskin N, Chowdhury A, Quinlan MA, Fraser A, Clark AG, Wynalda B, Martinez R, Groce EL, Reding M, Liang E, Shulga L, Huang C, Casper T, Clark M, Ho W, Gao Y, van Velthoven CTJ, Sobieski C, Ferrer R, Berg MR, Curtis BC, English C, Day JC, Fortuna MG, Donadio N, Newman D, Yao S, Chakka AB, Goldy J, Torkelson A, Guzman JB, Chakrabarty R, Nguy B, Guilford N, Pham TH, Wright V, Ronellenfitch K, Naidoo R, Kenney J, Williford A, Ramakrishnan C, Drinnenberg A, Gudsnuk K, Thyagarajan B, Smith KA, Dee N, Deisseroth K, Zeng H, Yao Z, Tasic B, Levi BP, Hodge R, Bakken TE, Lein ES, Ting JT, Daigle TL. Cell Rep. 2025 Jun 24;44(6):115730. doi: 10.1016/j.celrep.2025.115730. Epub 2025 May 21. 10.1016/j.celrep.2025.115730 PubMed 40403722