pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin
(Plasmid
#223962)
-
PurposeDual fluorescent reporter for histone H2B and for exogenous Rb
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-EF1a-IRES-blasticidin
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer For H2B-iRFP670: catttcaggtgtcgtgagggatccgccacc; For YFP-Rb: CCGGTCCTTCTAAAGGTGAAGAATTATTCACTGGTGTTGT
- 3′ sequencing primer For H2B-iRFP670: acctttagaaggaccgggattttcttccac; For YFP-Rb: cggccgccctcgaggaattcTTATTTCTCTTCCTTGTTTGAGGTATCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin was a gift from Hee Won Yang (Addgene plasmid # 223962 ; http://n2t.net/addgene:223962 ; RRID:Addgene_223962) -
For your References section:
Sequential activation of E2F via Rb degradation and c-Myc drives resistance to CDK4/6 inhibitors in breast cancer. Kim S, Armand J, Safonov A, Zhang M, Soni RK, Schwartz G, McGuinness JE, Hibshoosh H, Razavi P, Kim M, Chandarlapaty S, Yang HW. Cell Rep. 2023 Nov 28;42(11):113198. doi: 10.1016/j.celrep.2023.113198. Epub 2023 Oct 21. 10.1016/j.celrep.2023.113198 PubMed 37865915