pMSP1D1-Strep-II
(Plasmid
#224209)
-
PurposeMembrane scaffold protein (MSP1D1) with Strep-II tag. pMSP1D1, 7xHis tag swapped for a Strep-II tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET 28a
- Total vector size (bp) 5883
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMSP1D1-Strep-II
-
Alt nameMembrane scaffold protein
-
SpeciesSynthetic
-
MutationSubstitution of 7xHis tag found in pMSP1D1 for a Strep-II tag
- Promoter T7
-
Tag
/ Fusion Protein
- Strep-II Tag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pMSP1D1(#20061) was obtained from Addgene (Stephen Sligar). The N-term 7xHis tag was replaced with a Strep-II tag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP1D1-Strep-II was a gift from Anne Robinson (Addgene plasmid # 224209 ; http://n2t.net/addgene:224209 ; RRID:Addgene_224209) -
For your References section:
Ligand binding kinetics to evaluate the function and stability of A(2A)R in nanodiscs. Pettersen JM, McCracken O, Robinson AS. Biophys J. 2025 Jan 21;124(2):440-457. doi: 10.1016/j.bpj.2024.12.018. Epub 2024 Dec 17. 10.1016/j.bpj.2024.12.018 PubMed 39690743