pGEX-GST-BcPC-PLC
(Plasmid
#224255)
-
PurposeExpress N-terminal HRV 3C protease cleavable GST fused to Bacillus cereus PC-PLC in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX-6P-1
-
Backbone manufacturerCytiva
- Backbone size w/o insert (bp) 4265
- Total vector size (bp) 5117
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBacillus cereus phospholipase C
-
Alt namePhosphatidylcholine-specific phospholipase C
-
Alt namePC-PLC
-
Alt namePhospholipase C, EC:3.1.4.3,
-
SpeciesBacillus cereus ATCC 14579
-
Insert Size (bp)852
-
MutationThe gene of Bacillus cereus ATCC 14579 was used for cloning
-
GenBank IDQ81HW1 · Q81HW1_BACCR WP_000730997.1
-
Entrez GeneplC (a.k.a. C2I25_RS08115, C2I25_08115)
-
Entrez GeneplC (a.k.a. FOC91_RS06050, FOC91_06050)
- Promoter lac promoter
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- HRV-3C (LEVLFQGP) site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CATTAGGCACCCCAGGCTTTACACTTTATG
- 3′ sequencing primer GCTTACAGACAAGCTGTGACCGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-GST-BcPC-PLC was a gift from Chiaki Murakami (Addgene plasmid # 224255 ; http://n2t.net/addgene:224255 ; RRID:Addgene_224255) -
For your References section:
Development of a liquid chromatography-mass spectrometry based enzyme activity assay for phosphatidylcholine-specific phospholipase C. Murakami C, Mizuno S, Kado S, Sakane F. Anal Biochem. 2017 Jun 1;526:43-49. doi: 10.1016/j.ab.2017.03.010. Epub 2017 Mar 14. 10.1016/j.ab.2017.03.010 PubMed 28315318