pGL2 enhancer- F3 GATA mut
(Plasmid
#22430)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL2 Enhancer
- Backbone size w/o insert (bp) 5854
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameF3 GATA mut
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1055
-
GenBank IDHSU24214
-
Entrez GeneNOS3 (a.k.a. ECNOS, eNOS)
-
Tag
/ Fusion Protein
- luciferase reporter gene (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer see article (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GATA mutation oligo - GCTCCCACTTTAGAGCCTCAGT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL2 enhancer- F3 GATA mut was a gift from William Sessa (Addgene plasmid # 22430 ; http://n2t.net/addgene:22430 ; RRID:Addgene_22430) -
For your References section:
Functional analysis of the human endothelial nitric oxide synthase promoter. Sp1 and GATA factors are necessary for basal transcription in endothelial cells. Zhang R, Min W, Sessa WC. J Biol Chem. 1995 Jun 23. 270(25):15320-6. 10.1074/jbc.270.25.15320 PubMed 7541039