pFastBacI-KDAC8 H143A
(Plasmid
#224344)
-
PurposeExpresses human KDAC8 (HDAC8) H143A in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepFastBacI
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4682
- Total vector size (bp) 5855
-
Modifications to backboneRemoval of one NheI site
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC8
-
Alt nameHDAC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1173
-
MutationHistidine 143 mutated to alanine
-
Entrez GeneHDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTAGTGGTTGGCTACGTATACTC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon optimized for bacterial expression but expresses well in HighFive insect cells. The resulting protein is catalytically inactive.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBacI-KDAC8 H143A was a gift from Terry Watt (Addgene plasmid # 224344 ; http://n2t.net/addgene:224344 ; RRID:Addgene_224344) -
For your References section:
Purification of metal-dependent lysine deacetylases with consistently high activity. Toro TB, Painter RG, Haynes RA, Glotser EY, Bratton MR, Bryant JR, Nichols KA, Matthew-Onabanjo AN, Matthew AN, Bratcher DR, Perry CD, Watt TJ. Protein Expr Purif. 2018 Jan;141:1-6. doi: 10.1016/j.pep.2017.08.009. Epub 2017 Aug 24. 10.1016/j.pep.2017.08.009 PubMed 28843507