pJExpress401-KDAC8 D101R
(Plasmid
#224349)
-
PurposeExpresses human KDAC8 (HDAC8) D101R in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepJExpress401
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 5109
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC8
-
Alt nameHDAC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1173
-
MutationAspartate 101 mutated to arginine
-
Entrez GeneHDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
- Promoter T5
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer TGGTAGTGTGGGGACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon optimized for bacterial expression. The resulting protein has reduced catalytic activity compared to wild-type.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress401-KDAC8 D101R was a gift from Terry Watt (Addgene plasmid # 224349 ; http://n2t.net/addgene:224349 ; RRID:Addgene_224349) -
For your References section:
Lysine Deacetylase Substrate Selectivity: A Dynamic Ionic Interaction Specific to KDAC8. Toro TB, Swanier JS, Bezue JA, Broussard CG, Watt TJ. Biochemistry. 2021 Aug 24;60(33):2524-2536. doi: 10.1021/acs.biochem.1c00384. Epub 2021 Aug 6. 10.1021/acs.biochem.1c00384 PubMed 34357750