Skip to main content
Addgene

pFastBacI-KDAC8 D101E
(Plasmid #224350)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224350 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pFastBacI
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4682
  • Total vector size (bp) 5855
  • Modifications to backbone
    Removal of one NheI site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KDAC8
  • Alt name
    HDAC8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1173
  • Mutation
    Aspartate 101 mutated to glutamate
  • Entrez Gene
    HDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • TEV-cleavable His6 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGTGGTTGGCTACGTATACTC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Codon optimized for bacterial expression but expresses well in HighFive insect cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBacI-KDAC8 D101E was a gift from Terry Watt (Addgene plasmid # 224350 ; http://n2t.net/addgene:224350 ; RRID:Addgene_224350)
  • For your References section:

    Lysine Deacetylase Substrate Selectivity: A Dynamic Ionic Interaction Specific to KDAC8. Toro TB, Swanier JS, Bezue JA, Broussard CG, Watt TJ. Biochemistry. 2021 Aug 24;60(33):2524-2536. doi: 10.1021/acs.biochem.1c00384. Epub 2021 Aug 6. 10.1021/acs.biochem.1c00384 PubMed 34357750