pX459_GNB1L_gRNA
(Plasmid
#224377)
-
PurposeTargets GNB1L for dTAG C terminal knock-in cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX459
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNB1L
-
gRNA/shRNA sequenceAGGATCAGCGGATCAGCCTC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneGNB1L (a.k.a. DGCRK3, FKSG1, GY2, WDR14, WDVCF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459_GNB1L_gRNA was a gift from Junjie Chen (Addgene plasmid # 224377 ; http://n2t.net/addgene:224377 ; RRID:Addgene_224377) -
For your References section:
FACS-based genome-wide CRISPR screens define key regulators of DNA damage signaling pathways. Huang M, Yao F, Nie L, Wang C, Su D, Zhang H, Li S, Tang M, Feng X, Yu B, Chen Z, Wang S, Yin L, Mou L, Hart T, Chen J. Mol Cell. 2023 Aug 3;83(15):2810-2828.e6. doi: 10.1016/j.molcel.2023.07.004. 10.1016/j.molcel.2023.07.004 PubMed 37541219