pCDNA3.SLC17A1-flag
(Plasmid
#224418)
-
PurposeExpress SLC17A1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3
- Backbone size w/o insert (bp) 5450
- Total vector size (bp) 6851
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSolute carrier family 17 (sodium phosphate), member 1
-
Alt nameSLC17A1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1401
-
Entrez GeneSLC17A1 (a.k.a. NAPI-1, NPT-1, NPT1)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.SLC17A1-flag was a gift from Jonathan Long (Addgene plasmid # 224418 ; http://n2t.net/addgene:224418 ; RRID:Addgene_224418)