pcDNA3.1-Pur-BFP-P2A-otMx3
(Plasmid
#224555)
-
PurposeExpresses Oncorhynchus tshawytscha mx3 protein and BFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1-Pur-(-)
- Backbone size w/o insert (bp) 5528
- Total vector size (bp) 8264
-
Modifications to backboneBackbone = Addgene #200458
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP-P2A-otMx3
-
SpeciesOncorhynchus tshawytscha
-
Insert Size (bp)2766
-
Entrez GeneLOC112247235
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Pur-BFP-P2A-otMx3 was a gift from Bertrand Collet (Addgene plasmid # 224555 ; http://n2t.net/addgene:224555 ; RRID:Addgene_224555) -
For your References section:
Knockout of the antiviral genes mx1 or mx3 modulates the expression of paralogous genes in a salmonid cell line. Chaumont L, Peruzzi M, Huetz F, Raffy C, Le Hir J, Minke J, Leong JC, Boudinot P, Collet B. Fish Shellfish Immunol. 2026 Apr;171:111204. doi: 10.1016/j.fsi.2026.111204. Epub 2026 Feb 9. 10.1016/j.fsi.2026.111204 PubMed 41672287