Skip to main content

pCAG-3xGFP11-mem-3xPax7gRNA
(Plasmid #224571)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224571 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-memRFP
  • Modifications to backbone
    Guide RNAs inserted following memRFP, 3xGFP11-mem inserted in place of memRFP
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xGFP11
  • Alt name
    split GFP11
  • gRNA/shRNA sequence
    Pax7 gRNA1: aacccctaccaactggtcggggtttgaaacccgaatttgatgcgtagcacacg; Pax7 gRNA2: aacccctaccaactggtcggggtttgaaacccctttgtcgcccaggatgccat; Pax7 gRNA3: aacccctaccaactggtcggggtttgaaacattcatgtggttggcaggagctg
  • Mutation
    Codon optimized
  • GenBank ID
  • Tag / Fusion Protein
    • Membrane Localization Signal (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tacagctcctgggcaacgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-3xGFP11-mem-3xPax7gRNA was a gift from Erica Hutchins (Addgene plasmid # 224571 ; http://n2t.net/addgene:224571 ; RRID:Addgene_224571)
  • For your References section:

    CRISPR-Cas13d as a molecular tool to achieve targeted gene expression knockdown in chick embryos. Kim M, Hutchins EJ. Dev Biol. 2024 Nov 30:S0012-1606(24)00265-3. doi: 10.1016/j.ydbio.2024.11.013. 10.1016/j.ydbio.2024.11.013 PubMed 39622311