pET21b(+)_SARS-CoV-2_3CLpro_Q306A-HIS
(Plasmid
#224697)
-
PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro active protease with His-tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET21b(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6345
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21(DE3) for expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
-
Alt namensp5A_3CLpro and nsp5B_3CLpro
-
Alt namemain proteinase (Mpro)
-
SpeciesSARS-CoV-2 virus
-
Insert Size (bp)945
-
Mutationsilent mutation C to T at position 10546 (eliminating NdeI site); codon CAA for Q306 to codon GCA for A306 (eliminating natural 3CL autocleavage site)
-
GenBank IDNC_045512.2
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T7
-
Tag
/ Fusion Protein
- Gly-Gly-6xHis (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Silent mutation in the original sequence to delete a second NdeI site as NdeI was needed for cloning; codon coding for Q306 was mutated to codon coding for A306 to delete natural cleavage site of the 3CL-protease; two codons for glycine as a linker before the c-terminal 6x histag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21b(+)_SARS-CoV-2_3CLpro_Q306A-HIS was a gift from Christopher Overall (Addgene plasmid # 224697 ; http://n2t.net/addgene:224697 ; RRID:Addgene_224697) -
For your References section:
SARS-CoV-2 3CL(pro) (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL(pro). Grin PM, Baid K, de Jesus HCR, Kozarac N, Bell PA, Jiang SZ, Kappelhoff R, Butler GS, Leborgne NGF, Pan C, Pablos I, Machado Y, Vederas JC, Kim H, Benarafa C, Banerjee A, Overall CM. Cell Rep. 2024 Dec 24;43(12):115080. doi: 10.1016/j.celrep.2024.115080. Epub 2024 Dec 12. 10.1016/j.celrep.2024.115080 PubMed 39673710