Skip to main content

pET21b(+)_SARS-CoV-2_3CLpro_C145A-HIS
(Plasmid #224698)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224698 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pET21b(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6345
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21(DE3) for expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
  • Alt name
    nsp5A_3CLpro and nsp5B_3CLpro
  • Alt name
    main proteinase (Mpro)
  • Species
    SARS-CoV-2 virus
  • Insert Size (bp)
    945
  • Mutation
    silent mutation C to T at position 10546 (eliminating NdeI site); codon TGT for C145 to codon GCG for A145 (eliminating active site amino acid Cysteine); codon CAA for Q306 to codon GCA for A306 (eliminating natural 3CL autocleavage site)
  • GenBank ID
    NC_045512.2
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T7
  • Tag / Fusion Protein
    • Gly-Gly-6xHis (C terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Silent mutation in the original sequence to delete a second NdeI site as NdeI was needed for cloning; codon coding for active site residue C145 was mutated to A145 for inactive protease production; 6xHistag for purification

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21b(+)_SARS-CoV-2_3CLpro_C145A-HIS was a gift from Christopher Overall (Addgene plasmid # 224698 ; http://n2t.net/addgene:224698 ; RRID:Addgene_224698)
  • For your References section:

    SARS-CoV-2 3CL(pro) (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL(pro). Grin PM, Baid K, de Jesus HCR, Kozarac N, Bell PA, Jiang SZ, Kappelhoff R, Butler GS, Leborgne NGF, Pan C, Pablos I, Machado Y, Vederas JC, Kim H, Benarafa C, Banerjee A, Overall CM. Cell Rep. 2024 Dec 24;43(12):115080. doi: 10.1016/j.celrep.2024.115080. Epub 2024 Dec 12. 10.1016/j.celrep.2024.115080 PubMed 39673710