pcDNA3.1-GSDMD_H270A
(Plasmid
#224701)
-
PurposeExpression of mutated Gasdermin D_H270A (GSDMD_H270A) in transfected mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5393
- Total vector size (bp) 6845
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE. coli Top10 can also be used
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGSDMD_H270A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1452
-
MutationH270A
-
GenBank IDNM_024736.7
-
Entrez GeneGSDMD (a.k.a. DF5L, DFNA5L, FKSG10, GSDMDC1)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genscript used their original construct OHu03821D (NM_024736.7) to clone our customized construct. Cloning method: CloneEZ; Vector: pcDNA3.1+/C-(K)DYK. The insert has one mutation changing codon for amino acid H270 to A270 of Gasdermin-D (GSDMD).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-GSDMD_H270A was a gift from Christopher Overall (Addgene plasmid # 224701 ; http://n2t.net/addgene:224701 ; RRID:Addgene_224701) -
For your References section:
SARS-CoV-2 3CL(pro) (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL(pro). Grin PM, Baid K, de Jesus HCR, Kozarac N, Bell PA, Jiang SZ, Kappelhoff R, Butler GS, Leborgne NGF, Pan C, Pablos I, Machado Y, Vederas JC, Kim H, Benarafa C, Banerjee A, Overall CM. Cell Rep. 2024 Dec 24;43(12):115080. doi: 10.1016/j.celrep.2024.115080. Epub 2024 Dec 12. 10.1016/j.celrep.2024.115080 PubMed 39673710