Skip to main content
Addgene

pcDNA3.1-GSDMD_Q29A
(Plasmid #224702)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224702 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5393
  • Total vector size (bp) 6845
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    E. coli Top10 can also be used
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GSDMD_Q29A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1452
  • Mutation
    Q29A
  • GenBank ID
    NM_024736.7
  • Entrez Gene
    GSDMD (a.k.a. DF5L, DFNA5L, FKSG10, GSDMDC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genscript used their original construct OHu03821D (NM_024736.7) to clone our customized construct. Cloning method: CloneEZ; Vector: pcDNA3.1+/C-(K)DYK. The insert has one mutation changing codon for amino acid Q29 to A29 of Gasdermin-D (GSDMD).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-GSDMD_Q29A was a gift from Christopher Overall (Addgene plasmid # 224702 ; http://n2t.net/addgene:224702 ; RRID:Addgene_224702)
  • For your References section:

    SARS-CoV-2 3CL(pro) (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL(pro). Grin PM, Baid K, de Jesus HCR, Kozarac N, Bell PA, Jiang SZ, Kappelhoff R, Butler GS, Leborgne NGF, Pan C, Pablos I, Machado Y, Vederas JC, Kim H, Benarafa C, Banerjee A, Overall CM. Cell Rep. 2024 Dec 24;43(12):115080. doi: 10.1016/j.celrep.2024.115080. Epub 2024 Dec 12. 10.1016/j.celrep.2024.115080 PubMed 39673710