pFB1.HMBP.PrS.CBX8-KR21A
(Plasmid
#224709)
-
PurposeExpresses a human CBX8 mutant (KR21A) in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5869
- Total vector size (bp) 7036
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCBX8 KR21A mt
-
Alt namechromobox 8 KR21A mutant
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1167
-
GenBank ID57332
-
Entrez GeneCBX8 (a.k.a. PC3, RC1)
-
Tag
/ Fusion Protein
- HMBP (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GTCCGCTTTCTGGTATGCCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1.HMBP.PrS.CBX8-KR21A was a gift from Chen Davidovich (Addgene plasmid # 224709 ; http://n2t.net/addgene:224709 ; RRID:Addgene_224709) -
For your References section:
Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates. Uckelmann M, Levina V, Taveneau C, Han Ng X, Pandey V, Martinez J, Mendiratta S, Houx J, Boudes M, Venugopal H, Trepout S, Zhang Q, Flanigan S, Li M, Sierecki E, Gambin Y, Das PP, Bell O, de Marco A, Davidovich C. bioRxiv [Preprint]. 2024 Feb 12:2023.05.08.539931. doi: 10.1101/2023.05.08.539931. 10.1101/2023.05.08.539931 PubMed 38405976