Skip to main content

pGEMHE:mTREK-1 (S131A/C159A/C219A)
(Plasmid #224753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEMHE
  • Vector type
    In vitro transcription for Oocyte expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Potassium channel subfamily K member 2
  • Alt name
    Kcnk2
  • Alt name
    TREK-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1236
  • Mutation
    S131A/C159A/C219A
  • Entrez Gene
    Kcnk2 (a.k.a. A430027H14Rik, TREK-1)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE:mTREK-1 (S131A/C159A/C219A) was a gift from Dan Minor (Addgene plasmid # 224753 ; http://n2t.net/addgene:224753 ; RRID:Addgene_224753)
  • For your References section:

    Development of covalent chemogenetic K(2P) channel activators. Deal PE, Lee H, Mondal A, Lolicato M, Mendonca PRF, Black H, Jang S, El-Hilali X, Bryant C, Isacoff EY, Renslo AR, Minor DL Jr. Cell Chem Biol. 2024 Jul 18;31(7):1305-1323.e9. doi: 10.1016/j.chembiol.2024.06.006. 10.1016/j.chembiol.2024.06.006 PubMed 39029456