pAcGFP-C1-DGKd2
(Plasmid
#224897)
-
PurposeExpress N-terminal mCherry fused to human diacylglycerol kinase delta isoform 2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAcGFP-C1
-
Backbone manufacturerClontech Laboratories, Inc. A Takara Bio Company
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 8373
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDGKD
-
Alt nameDiacylglycerol kinase delta 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3642
-
GenBank IDNM_152879.3
-
Entrez GeneDGKD (a.k.a. DGK-delta, DGKdelta, dgkd-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- AcGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcpRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcGFP-C1-DGKd2 was a gift from Chiaki Murakami (Addgene plasmid # 224897 ; http://n2t.net/addgene:224897 ; RRID:Addgene_224897)