Skip to main content
Addgene

pGEX6P1-CD28 CAR hinge (I114 – P152)
(Plasmid #224929)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224929 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6P-1
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 5104
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD28 CAR hinge (I114 – P152)
  • Alt name
    CD28H
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    120
  • GenBank ID
    AAA60581.1
  • Entrez Gene
    TMIGD2 (a.k.a. CD28H, IGPR-1, IGPR1)
  • Tag / Fusion Protein
    • glutathione-S-transferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GenScript USA, Inc.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-CD28 CAR hinge (I114 – P152) was a gift from Kylie Walters (Addgene plasmid # 224929 ; http://n2t.net/addgene:224929 ; RRID:Addgene_224929)
  • For your References section:

    CD28 hinge used in chimeric antigen receptor (CAR) T-cells exhibits local structure and conformational exchange amidst global disorder. Folimonova V, Chen X, Negi H, Schwieters CD, Li J, Byrd RA, Taylor N, Youkharibache P, Walters KJ. Commun Biol. 2024 Aug 31;7(1):1072. doi: 10.1038/s42003-024-06770-w. 10.1038/s42003-024-06770-w PubMed 39217198