PB-TRE-ETV2
(Plasmid
#225051)
-
PurposePiggyBac vector encoding doxycycline-inducible codon-optimized human ETV2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-TRE3G
- Backbone size w/o insert (bp) 8075
- Total vector size (bp) 9104
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameETS Variant Transcription Factor 2
-
Alt nameETV2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1029
-
MutationCodon Optimized
-
GenBank IDNP_001287903.1
-
Entrez GeneETV2 (a.k.a. ER71, ETSRP71)
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GTACGGTGGGCGCCTATAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE-ETV2 was a gift from Sean Palecek & Eric Shusta (Addgene plasmid # 225051 ; http://n2t.net/addgene:225051 ; RRID:Addgene_225051) -
For your References section:
ETV2 Overexpression Promotes Efficient Differentiation of Pluripotent Stem Cells to Endothelial Cells. Ding Y, Tamhankar S, Du F, Christopherson T, Schlueter N, Cohen JR, Shusta EV, Palecek SP. Biotechnol Bioeng. 2025 Jul;122(7):1914-1928. doi: 10.1002/bit.28979. Epub 2025 Mar 25. 10.1002/bit.28979 PubMed 40134129