pSicoR (Puro) NEMO shRNA2
(Plasmid
#22506)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSicoR PGK puro
-
Backbone manufacturerAvailable at Addgene (#12084)
- Backbone size w/o insert (bp) 7700
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNEMO shRNA2
-
Alt nameNEMO
-
SpeciesM. musculus (mouse)
-
Entrez GeneIkbkg (a.k.a. 1110037D23Rik, IKK[g], NEMO)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer mU6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mouse NEMO shRNA2 in pSicoReverse (Puromycin)
forward oligo:
TGGACAAGGCCTCTGTGAAATTCAAGAGATTTCACAGAGGCCTTGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACAAGGCCTCTGTGAAATCTCTTGAATTTCACAGAGGCCTTGTCCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR (Puro) NEMO shRNA2 was a gift from Tyler Jacks (Addgene plasmid # 22506 ; http://n2t.net/addgene:22506 ; RRID:Addgene_22506) -
For your References section:
Requirement for NF-kappaB signalling in a mouse model of lung adenocarcinoma. Meylan E, Dooley AL, Feldser DM, Shen L, Turk E, Ouyang C, Jacks T. Nature. 2009 Nov 5;462(7269):104-7. doi: 10.1038/nature08462. Epub 2009 Oct 21. 10.1038/nature08462 PubMed 19847165