Skip to main content

pcDNA3.1-ar1
(Plasmid #225219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    androgen receptor 1
  • Alt name
    ar1
  • Alt name
    ara
  • Species
    Oreochromis niloticus
  • GenBank ID
    100534409
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (unknown if destroyed)
  • 3′ cloning site Xho I (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGAAGGCACAGTCGAGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-ar1 was a gift from Deshou Wang (Addgene plasmid # 225219 ; http://n2t.net/addgene:225219 ; RRID:Addgene_225219)
  • For your References section:

    Steroid hormone-deprived sex reversal in cyp11a1 mutant XX tilapia experiences an ovary-like stage at molecular level. Xiao H, Wang L, Yan S, Ma H, Xu Z, Wang F, Wang J, Tao W, Wang D. Commun Biol. 2024 Sep 16;7(1):1154. doi: 10.1038/s42003-024-06853-8. 10.1038/s42003-024-06853-8 PubMed 39284885
Commonly requested with: