pcDNA3.1-ar2
(Plasmid
#225220)
-
PurposeExpression androgen receptor 2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7800
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameandrogen receptor 2
-
Alt namear1
-
Alt namearb
-
SpeciesOreochromis niloticus
-
Insert Size (bp)2300
-
GenBank ID100534410
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (unknown if destroyed)
- 3′ cloning site Xho I (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGAAGGCACAGTCGAGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-ar2 was a gift from Deshou Wang (Addgene plasmid # 225220 ; http://n2t.net/addgene:225220 ; RRID:Addgene_225220) -
For your References section:
Steroid hormone-deprived sex reversal in cyp11a1 mutant XX tilapia experiences an ovary-like stage at molecular level. Xiao H, Wang L, Yan S, Ma H, Xu Z, Wang F, Wang J, Tao W, Wang D. Commun Biol. 2024 Sep 16;7(1):1154. doi: 10.1038/s42003-024-06853-8. 10.1038/s42003-024-06853-8 PubMed 39284885