hTRAK1(S200A, S201A, S719A, S919A)
(Plasmid
#225225)
-
PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, S919A)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-Tag3A-myc vector
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 4333
- Total vector size (bp) 7198
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametrak1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2910
-
MutationS200A, S201A, S719A, S919A mutations
-
Entrez GeneTRAK1 (a.k.a. DEE68, EIEE68, MILT1, OIP106)
- Promoter CMV
-
Tag
/ Fusion Protein
- MYC (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was made by performing site directed mutagenesis of Addgene plasmid 225204
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hTRAK1(S200A, S201A, S719A, S919A) was a gift from Thomas Schwarz (Addgene plasmid # 225225 ; http://n2t.net/addgene:225225 ; RRID:Addgene_225225) -
For your References section:
Energy stress activates AMPK to arrest mitochondria via phosphorylation of TRAK1. Falk JE, Henke T, Gowrisankaran S, Wanderoy S, Basu H, Greally S, Steen J, Schwarz TL. J Cell Biol. 2026 Apr 6;225(4):e202501023. doi: 10.1083/jcb.202501023. Epub 2026 Jan 30. 10.1083/jcb.202501023 PubMed 41615403