pCMV-meGFP-Myo6
(Plasmid
#225227)
-
PurposeExpresses GFP-tagged Myo6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene plasmid 54759
-
Backbone manufacturerMIchael Davidson (Addgnee)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo6
-
Entrez GeneMYO6 (a.k.a. DFNA22, DFNB37)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site PspOMI (not destroyed)
- 5′ sequencing primer CMV
- 3′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHuman Myo6 was purchased from Transomic (clone ID = GenBank: BC146764.1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-meGFP-Myo6 was a gift from Thomas Schwarz (Addgene plasmid # 225227 ; http://n2t.net/addgene:225227 ; RRID:Addgene_225227) -
For your References section:
Energy stress activates AMPK to arrest mitochondria via phosphorylation of TRAK1. Falk JE, Henke T, Gowrisankaran S, Wanderoy S, Basu H, Greally S, Steen J, Schwarz TL. J Cell Biol. 2026 Apr 6;225(4):e202501023. doi: 10.1083/jcb.202501023. Epub 2026 Jan 30. 10.1083/jcb.202501023 PubMed 41615403