Skip to main content
Addgene
Open Menu

pCMV-meGFP-Myo6
(Plasmid #225227)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225227 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    Addgene plasmid 54759
  • Backbone manufacturer
    MIchael Davidson (Addgnee)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo6
  • Entrez Gene
    MYO6 (a.k.a. DFNA22, DFNB37)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site PspOMI (not destroyed)
  • 5′ sequencing primer CMV
  • 3′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Human Myo6 was purchased from Transomic (clone ID = GenBank: BC146764.1)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-meGFP-Myo6 was a gift from Thomas Schwarz (Addgene plasmid # 225227 ; http://n2t.net/addgene:225227 ; RRID:Addgene_225227)

  • For your References section:

    Energy stress activates AMPK to arrest mitochondria via phosphorylation of TRAK1. Falk JE, Henke T, Gowrisankaran S, Wanderoy S, Basu H, Greally S, Steen J, Schwarz TL. J Cell Biol. 2026 Apr 6;225(4):e202501023. doi: 10.1083/jcb.202501023. Epub 2026 Jan 30. 10.1083/jcb.202501023 PubMed 41615403
Related items: