pCMV-MCS-P2A-meGFP(omp25mts)
(Plasmid
#225270)
-
PurposeVector with a multiple cloning site, a P2A ribosome skip sequence and a mitochondria targeted mEGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene plasmid 225268
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCS-P2A-meGFP(omp25mts)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-MCS-P2A-meGFP(omp25mts) was a gift from Thomas Schwarz (Addgene plasmid # 225270 ; http://n2t.net/addgene:225270 ; RRID:Addgene_225270) -
For your References section:
Energy stress activates AMPK to arrest mitochondria via phosphorylation of TRAK1. Falk JE, Henke T, Gowrisankaran S, Wanderoy S, Basu H, Greally S, Steen J, Schwarz TL. J Cell Biol. 2026 Apr 6;225(4):e202501023. doi: 10.1083/jcb.202501023. Epub 2026 Jan 30. 10.1083/jcb.202501023 PubMed 41615403