pX459_LIG4_Exon3
(Plasmid
#225363)
-
PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
- Backbone size w/o insert (bp) 9152
- Total vector size (bp) 9172
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLIG4
-
gRNA/shRNA sequenceGCATAATGTCACTACAGATC
-
SpeciesH. sapiens (human)
-
Entrez GeneLIG4 (a.k.a. LIG4S)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This protospacer sequence was previously defined by others (doi:10.1038/s41586-018-0461-z).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459_LIG4_Exon3 was a gift from Sujatha Jagannathan (Addgene plasmid # 225363 ; http://n2t.net/addgene:225363 ; RRID:Addgene_225363) -
For your References section:
SelectRepair Knockout: Efficient PTC-Free Gene Knockout Through Selectable Homology-Directed DNA Repair. Cortazar MA, Jagannathan S. Methods Mol Biol. 2025;2863:397-417. doi: 10.1007/978-1-0716-4176-7_23. 10.1007/978-1-0716-4176-7_23 PubMed 39535722