pDGB3_o1_LIR-2nd intron-3'eGFP-T35S-SIR-p35S-5'eGFP-1st intron-LIR (GB5177)
(Plasmid
#225442)
-
PurposeBeYDV LIR:2nd intron + 3'eGFP +T35S:BeYDV SIR + p35S + 5'eGFP + 1st intron:BeYDV LIR for INPACT configuration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB3_omega1
-
Backbone manufacturerself-made
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLIR:2nd intron:3'eGFP:T35S:SIR:p35S:5'eGFP:1st intron:LIR
-
SpeciesSynthetic
-
Insert Size (bp)3052
-
MutationBsaI and BsmBI sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ggtggcaggatatattgtgg
- 3′ sequencing primer cgcccttttaaatatccgatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI.
Please visit https://doi.org/10.1101/2024.04.30.591823 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3_o1_LIR-2nd intron-3'eGFP-T35S-SIR-p35S-5'eGFP-1st intron-LIR (GB5177) was a gift from Diego Orzaez (Addgene plasmid # 225442 ; http://n2t.net/addgene:225442 ; RRID:Addgene_225442) -
For your References section:
CuBe: a geminivirus-based copper-regulated expression system suitable for post-harvest activation. Garcia-Perez E, Vazquez-Vilar M, Lozano-Duran R, Orzaez D. Plant Biotechnol J. 2025 Jan;23(1):141-155. doi: 10.1111/pbi.14485. Epub 2024 Oct 22. 10.1111/pbi.14485 PubMed 39435699