Skip to main content

pDGB3_alpha2_BeYDV geminino 2.0 (no ATG)-eGFP (GB5178)
(Plasmid #225443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225443 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB3_alpha2
  • Backbone manufacturer
    self-made
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
  • Species
    Synthetic
  • Insert Size (bp)
    3054
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ggtggcaggatatattgtgg
  • 3′ sequencing primer cgcccttttaaatatccgatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmbI.
Please visit https://doi.org/10.1101/2024.04.30.591823 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3_alpha2_BeYDV geminino 2.0 (no ATG)-eGFP (GB5178) was a gift from Diego Orzaez (Addgene plasmid # 225443 ; http://n2t.net/addgene:225443 ; RRID:Addgene_225443)
  • For your References section:

    CuBe: a geminivirus-based copper-regulated expression system suitable for post-harvest activation. Garcia-Perez E, Vazquez-Vilar M, Lozano-Duran R, Orzaez D. Plant Biotechnol J. 2025 Jan;23(1):141-155. doi: 10.1111/pbi.14485. Epub 2024 Oct 22. 10.1111/pbi.14485 PubMed 39435699