Skip to main content
Addgene

ECMAB - pET22b Ag43 160N 6H Mms6
(Plasmid #225539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225539 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET22b
  • Backbone size w/o insert (bp) 5361
  • Total vector size (bp) 8357
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    18 °C for induction
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Iron binding protein
  • Alt name
    Mms6
  • Species
    Magnetospirillum magneticum AMB-1 strain
  • Insert Size (bp)
    396
  • GenBank ID
    3805266
  • Promoter T7
  • Tag / Fusion Protein
    • no

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Autotransporter protein
  • Alt name
    Ag43
  • Species
    Escherichia coli
  • Insert Size (bp)
    2480
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ECMAB - pET22b Ag43 160N 6H Mms6 was a gift from Urartu Seker (Addgene plasmid # 225539 ; http://n2t.net/addgene:225539 ; RRID:Addgene_225539)
  • For your References section:

    Engineered Bacteria with Genetic Circuits Accumulating Nanomagnets as MRI Contrast Agents. Yavuz M, Utkur M, Kehribar ES, Yagiz E, Saritas EU, Seker UOS. Small. 2022 Jul;18(26):e2200537. doi: 10.1002/smll.202200537. Epub 2022 May 13. 10.1002/smll.202200537 PubMed 35567331