ECMAB - pET22b Ag43 160N 6H Mms6
(Plasmid
#225539)
-
PurposeConstruction of extracellular magnetite accumulating bacterial systems.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET22b
- Backbone size w/o insert (bp) 5361
- Total vector size (bp) 8357
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions18 °C for induction
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameIron binding protein
-
Alt nameMms6
-
SpeciesMagnetospirillum magneticum AMB-1 strain
-
Insert Size (bp)396
-
GenBank ID3805266
- Promoter T7
-
Tag
/ Fusion Protein
- no
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAutotransporter protein
-
Alt nameAg43
-
SpeciesEscherichia coli
-
Insert Size (bp)2480
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ECMAB - pET22b Ag43 160N 6H Mms6 was a gift from Urartu Seker (Addgene plasmid # 225539 ; http://n2t.net/addgene:225539 ; RRID:Addgene_225539) -
For your References section:
Engineered Bacteria with Genetic Circuits Accumulating Nanomagnets as MRI Contrast Agents. Yavuz M, Utkur M, Kehribar ES, Yagiz E, Saritas EU, Seker UOS. Small. 2022 Jul;18(26):e2200537. doi: 10.1002/smll.202200537. Epub 2022 May 13. 10.1002/smll.202200537 PubMed 35567331