pEMS2389
(Plasmid
#225634)
-
PurposeAAV plasmid with Ple391 (DRD2 MiniPromoter) driving expression of EmGFP. Contains WPRE.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225634 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepEMS2131
-
Backbone manufacturerElizabeth Simpson (Addgene plasmid # 111895)
- Backbone size w/o insert (bp) 4999
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsWe also recommend using “SURE” cells from Agilent, that the colonies are freshly picked, and that you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePle391
-
Alt nameDRD2 MiniPromoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1723
-
Entrez GeneDRD2 (a.k.a. D2DR, D2R)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
- 3′ sequencing primer oEMS6163 (GGTTCTTGATCCCTTCTGAC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMS2389 was a gift from Elizabeth Simpson (Addgene plasmid # 225634 ; http://n2t.net/addgene:225634 ; RRID:Addgene_225634) -
For your References section:
New MiniPromoter Ple389 (ADORA2A) drives selective expression in medium spiny neurons in mice and non-human primates. de Moura Gomes A, L Petkau T, J Korecki A, Fornes O, Galvan A, Lu G, M Hill A, Ling Lam S, Yao A, A Farkas R, W Wasserman W, Smith Y, M Simpson E, R Leavitt B. Sci Rep. 2024 Nov 15;14(1):28194. doi: 10.1038/s41598-024-79004-y. 10.1038/s41598-024-79004-y PubMed 39548191