Skip to main content
Addgene

pEMS2386
(Plasmid #225639)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225639 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pEMS2131
  • Backbone manufacturer
    Elizabeth Simpson (Addgene plasmid # 111895)
  • Backbone size w/o insert (bp) 4999
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    We also recommend using “SURE” cells from Agilent, that the colonies are freshly picked, and that you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ple388
  • Alt name
    PITX3 MiniPromoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1702
  • Entrez Gene
    PITX3 (a.k.a. ASGD1, ASMD, ASOD, CTPP4, CTRCT11, PTX3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
  • 3′ sequencing primer oEMS6163 (GGTTCTTGATCCCTTCTGAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEMS2386 was a gift from Elizabeth Simpson (Addgene plasmid # 225639 ; http://n2t.net/addgene:225639 ; RRID:Addgene_225639)
  • For your References section:

    OnTarget: in silico design of MiniPromoters for targeted delivery of expression. Fornes O, Av-Shalom TV, Korecki AJ, Farkas RA, Arenillas DJ, Mathelier A, Simpson EM, Wasserman WW. Nucleic Acids Res. 2023 Jul 5;51(W1):W379-W386. doi: 10.1093/nar/gkad375. 10.1093/nar/gkad375 PubMed 37166953