pcDNA3.1-Pur-ottlr3
(Plasmid
#225641)
-
PurposeExpresses the Oncorhynchus tshawytscha toll-like receptor 3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5111
- Total vector size (bp) 7854
-
Modifications to backboneModified backbone = pcDNA3.1-(-)-Pur (Addgene #200458)
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameToll-like receptor 3
-
Alt nametlr3
-
SpeciesOncorhynchus tshawytscha
-
Insert Size (bp)2743
-
GenBank IDXM_024398587
-
Entrez Genetlr3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert was obtained by gene synthesis (Thermofisher GENART service) and was subloned into pcDNA3.1-Pur.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Pur-ottlr3 was a gift from Bertrand Collet (Addgene plasmid # 225641 ; http://n2t.net/addgene:225641 ; RRID:Addgene_225641) -
For your References section:
Toll-like Receptor 3 is Required for Sensing Extracellular Double Stranded RNA in Salmonid Cells. Collet B, Collins C, Peruzzi M, Catherine-Mezeray J, DeWitte-Orr S, Rebl A, Boudinot P. Mar Biotechnol (NY). 2026 Feb 27;28(2):41. doi: 10.1007/s10126-026-10590-w. 10.1007/s10126-026-10590-w PubMed 41748847