Skip to main content

pCDH-IFNA-neo
(Plasmid #225710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225710 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH
  • Backbone size w/o insert (bp) 7561
  • Total vector size (bp) 8131
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IFNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    570
  • GenBank ID
    BC112300.1
  • Entrez Gene
    IFNA1 (a.k.a. IFL, IFN, IFN-ALPHA, IFN-alphaD, IFNA13, IFNA@, leIF D)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site AsiSI (unknown if destroyed)
  • 5′ sequencing primer agaagattctagagctagc atggcctcgccctttgct
  • 3′ sequencing primer acgggcaccggagcgatcgc agatccttcgcggccgatccat ttattccttcctccttaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.doi.org/10.17632/g75gzdwbks.1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-IFNA-neo was a gift from Eun Hee Han (Addgene plasmid # 225710 ; http://n2t.net/addgene:225710 ; RRID:Addgene_225710)
  • For your References section:

    STAT1 as a tool for non-invasive monitoring of NK cell activation in cancer. Min JY, Kim HM, Lee H, Cho MY, Park HS, Lee SY, Park MS, Ha SK, Kim D, Jeong HG, Kim TD, Hong KS, Han EH. Commun Biol. 2024 Sep 30;7(1):1222. doi: 10.1038/s42003-024-06917-9. 10.1038/s42003-024-06917-9 PubMed 39349746