pCDH-IFNA-neo
(Plasmid
#225710)
-
PurposeThe pCDH-IFNA-neo plasmid is designed for the overexpression of human IFNα in mammalian cells. This plasmid was utilized to engineer A549 cells for stable IFNα overexpression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH
- Backbone size w/o insert (bp) 7561
- Total vector size (bp) 8131
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIFNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)570
-
GenBank IDBC112300.1
-
Entrez GeneIFNA1 (a.k.a. IFL, IFN, IFN-ALPHA, IFN-alphaD, IFNA13, IFNA@, leIF D)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site AsiSI (unknown if destroyed)
- 5′ sequencing primer agaagattctagagctagc atggcctcgccctttgct
- 3′ sequencing primer acgggcaccggagcgatcgc agatccttcgcggccgatccat ttattccttcctccttaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.doi.org/10.17632/g75gzdwbks.1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-IFNA-neo was a gift from Eun Hee Han (Addgene plasmid # 225710 ; http://n2t.net/addgene:225710 ; RRID:Addgene_225710) -
For your References section:
STAT1 as a tool for non-invasive monitoring of NK cell activation in cancer. Min JY, Kim HM, Lee H, Cho MY, Park HS, Lee SY, Park MS, Ha SK, Kim D, Jeong HG, Kim TD, Hong KS, Han EH. Commun Biol. 2024 Sep 30;7(1):1222. doi: 10.1038/s42003-024-06917-9. 10.1038/s42003-024-06917-9 PubMed 39349746