pET24a isPETase
(Plasmid
#225759)
-
PurposeExpresses codon-optimized PETase from Ideonella sakaiensis in E. coli without native signal sequence and with a C-terminal his-tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET24a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6022
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameisPETase
-
SpeciesIdeonella sakaiensis
-
Insert Size (bp)798
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcgaaattaatacgactcactataggg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET24a isPETase was a gift from Jason Boock (Addgene plasmid # 225759 ; http://n2t.net/addgene:225759 ; RRID:Addgene_225759) -
For your References section:
Increased cytoplasmic expression of PETase enzymes in E. coli. Carter LM, MacFarlane CE, Karlock SP, Sen T, Kaar JL, Berberich JA, Boock JT. Microb Cell Fact. 2024 Nov 25;23(1):319. doi: 10.1186/s12934-024-02585-w. 10.1186/s12934-024-02585-w PubMed 39582006