Skip to main content

pET24a isPETase
(Plasmid #225759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225759 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET24a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6022
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    isPETase
  • Species
    Ideonella sakaiensis
  • Insert Size (bp)
    798
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcgaaattaatacgactcactataggg
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET24a isPETase was a gift from Jason Boock (Addgene plasmid # 225759 ; http://n2t.net/addgene:225759 ; RRID:Addgene_225759)
  • For your References section:

    Increased cytoplasmic expression of PETase enzymes in E. coli. Carter LM, MacFarlane CE, Karlock SP, Sen T, Kaar JL, Berberich JA, Boock JT. Microb Cell Fact. 2024 Nov 25;23(1):319. doi: 10.1186/s12934-024-02585-w. 10.1186/s12934-024-02585-w PubMed 39582006