-
PurposeExpresses codon-optimized FAST-PETase in E. coli with a C-terminal his-tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6155
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFAST-PETase
-
Insert Size (bp)798
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcgaaattaatacgactcactataggg
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21b FAST-PETase was a gift from Jason Boock (Addgene plasmid # 225760 ; http://n2t.net/addgene:225760 ; RRID:Addgene_225760) -
For your References section:
Increased cytoplasmic expression of PETase enzymes in E. coli. Carter LM, MacFarlane CE, Karlock SP, Sen T, Kaar JL, Berberich JA, Boock JT. Microb Cell Fact. 2024 Nov 25;23(1):319. doi: 10.1186/s12934-024-02585-w. 10.1186/s12934-024-02585-w PubMed 39582006