pRC065d
(Plasmid
#225979)
-
PurposedRxCas13d expressed from J23107 promoter with J23119-driven crRNA (non-cognate DR)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15a
- Total vector size (bp) 4982
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedRxCas13d
- Promoter J23107
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebuj1 crRNA (non-cognate DR) targets the unstructured RBS
-
Alt namegRNA: AGAACGTCTTCGCTACTCGCCATGGTA
-
SpeciesSynthetic
- Promoter J23119
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRC065d was a gift from Jesse Zalatan (Addgene plasmid # 225979 ; http://n2t.net/addgene:225979 ; RRID:Addgene_225979) -
For your References section:
CRISPR-Cas tools for simultaneous transcription & translation control in bacteria. Cardiff RAL, Faulkner ID, Beall JG, Carothers JM, Zalatan JG. Nucleic Acids Res. 2024 May 22;52(9):5406-5419. doi: 10.1093/nar/gkae275. 10.1093/nar/gkae275 PubMed 38613390