pAG1guide_RUBY_EggCas9
(Plasmid
#225983)
-
PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plants
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone35s:RUBY and pRU53
-
Vector typePlant Expression, CRISPR
-
Selectable markersRUBY (35s:RUBY)
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGuide RNA against AtAGAMOUS1
-
gRNA/shRNA sequencegttttagagctagaaatagcaagttaaaataaggc
-
SpeciesA. thaliana (mustard weed)
- Promoter 35s promoter to Drive RUBY and DD45p to drive Cas9
Cloning Information
- Cloning method Gateway Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG1guide_RUBY_EggCas9 was a gift from Imran Siddiqi (Addgene plasmid # 225983 ; http://n2t.net/addgene:225983 ; RRID:Addgene_225983)