pEF2-EFGR-hTyro
(Plasmid
#225998)
-
PurposeExpresses a chimeric construct having N-terminal human EGFR and C-terminal human Tyro3
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF2
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttcttccatttcaggtgtcg
- 3′ sequencing primer gtcgaggctgatcagcgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF2-EFGR-hTyro was a gift from Raymond Birge & Sergei Kotenko (Addgene plasmid # 225998 ; http://n2t.net/addgene:225998 ; RRID:Addgene_225998) -
For your References section:
Normalization of TAM post-receptor signaling reveals a cell invasive signature for Axl tyrosine kinase. Kimani SG, Kumar S, Davra V, Chang YJ, Kasikara C, Geng K, Tsou WI, Wang S, Hoque M, Bohac A, Lewis-Antes A, De Lorenzo MS, Kotenko SV, Birge RB. Cell Commun Signal. 2016 Sep 6;14(1):19. doi: 10.1186/s12964-016-0142-1. 10.1186/s12964-016-0142-1 PubMed 27595981