pGL3-hL1-gRNA2-EGFP
(Plasmid
#226003)
-
PurposeCRISPRi-KD of human LINE1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-U6-sgRNA-EGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human L1HS
-
gRNA/shRNA sequencecttaggtaaacaaagcagca
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-hL1-gRNA2-EGFP was a gift from Miguel Ramalho-Santos (Addgene plasmid # 226003 ; http://n2t.net/addgene:226003 ; RRID:Addgene_226003) -
For your References section:
LINE1 and PRC2 control nucleolar organization and repression of the 8C state in human ESCs. Zhang J, Ataei L, Mittal K, Wu L, Caldwell L, Huynh L, Sarajideen S, Tse K, Simon MM, Mazid MA, Cook DP, Trcka D, Kwan T, Hoffman MM, Wrana JL, Esteban MA, Ramalho-Santos M. Dev Cell. 2024 Oct 14:S1534-5807(24)00574-4. doi: 10.1016/j.devcel.2024.09.024. 10.1016/j.devcel.2024.09.024 PubMed 39413784