pDIV151
              
              
                (Plasmid
                
                #226180)
              
            
            
            
          - 
            PurposeExpresses Cas9 in a backbone compatible with K. phaffii.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDIV019
- Total vector size (bp) 9848
- 
              Vector typeBacterial Expression, Yeast Expression, CRISPR
- 
                Selectable markersNourseothricin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameCas9
- 
                    SpeciesS. cerevisiae (budding yeast), Synthetic; Komagataella phaffii
- Promoter GAP1
- 
    
        Tag
        / Fusion Protein
    - SV40 (C terminal on insert)
 
Cloning Information
- Cloning method Other
- 5′ sequencing primer CCATATTAACATAACATGTATATAAACGTC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pDIV151 was a gift from Uffe Mortensen (Addgene plasmid # 226180 ; http://n2t.net/addgene:226180 ; RRID:Addgene_226180)
- 
                For your References section: Oligonucleotide-based CRISPR-Cas9 toolbox for efficient engineering of Komagataella phaffii. Strucko T, Gadar-Lopez AE, Frohling FB, Frost ET, Iversen EF, Olsson H, Jarczynska ZD, Mortensen UH. FEMS Yeast Res. 2024 Aug 23:foae026. doi: 10.1093/femsyr/foae026. 10.1093/femsyr/foae026 PubMed 39179418
 
    
 
                         
             
            