Skip to main content
Addgene

pENTR/HA-hBIG2
(Plasmid #226252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226252 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR3C
  • Vector type
    Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BIG2
  • Species
    H. sapiens (human)
  • Entrez Gene
    ARFGEF2 (a.k.a. BIG2, PVNH2, dJ1164I10.1)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI/BglI fragment (not destroyed)
  • 3′ cloning site BglI/NotI fragment (not destroyed)
  • 5′ sequencing primer gttagttacttaagctcgggc
  • 3′ sequencing primer gattttgagacacgggccag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to amplify BIG1 and BIG2 plasmids:
1. Plasmids containing BIG1 and BIG2 appear to be detrimental to bacterial growth. After transformation, an extended incubation time is required to obtain colonies in comparison to usual transformed bacteria. Additionally, the colonies are smaller than usual ones. Therefore, take small colonies for liquid culture. (We were usually using DH5a for transformation.)
2. Mini-prep: For 3~5 mL liquid culture from a single colony, use very fresh colonies; otherwise plasmid yields may be significantly reduced.
3. Maxi-prep (Large scale prep): Do not make a preculture from a single colony for large scale culture. I recommend directly inoculating all transformed bacteria into the large scale culture (200 mL ~ of ampicillin containing medium), after transformation and recovery culture. This helps a lot to get enough plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR/HA-hBIG2 was a gift from Hye-Won Shin (Addgene plasmid # 226252 ; http://n2t.net/addgene:226252 ; RRID:Addgene_226252)