pML107-LUG1
(Plasmid
#226265)
-
PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepML107
-
Backbone manufacturerLaughery et al, 2015, Yeast
- Backbone size w/o insert (bp) 12367
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLUG1 gRNA
-
Alt nameYLR352W
-
gRNA/shRNA sequenceTCTTCAAGTTACTCCAAGAG
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneYLR352W
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.08.28.610086 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML107-LUG1 was a gift from Jolanda Van Leeuwen (Addgene plasmid # 226265 ; http://n2t.net/addgene:226265 ; RRID:Addgene_226265) -
For your References section:
Genetic suppression interactions are highly conserved across genetically diverse yeast isolates. Paltenghi C, van Leeuwen J. G3 (Bethesda). 2025 Mar 3:jkaf047. doi: 10.1093/g3journal/jkaf047. 10.1093/g3journal/jkaf047 PubMed 40037589